Skip to Content
Merck

EHU062481

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK3

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGGAAGCCATGAGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTGCTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTAAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTCCTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAGGGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCTAACCGGCCCATCTTCCCTGGCAAGCACTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Osamu Otabe et al.
Oncology reports, 37(1), 98-104 (2016-11-15)
In alveolar rhabdomyosarcoma (ARMS) that is a highly malignant pediatric soft tissue tumor, MET, a receptor of hepatocyte growth factor (HGF), was reported to be downstream of the PAX3-FOXO1 fusion gene specific to ARMS, and a key mediator of metastatic
Yunching Chen et al.
Scientific reports, 7, 44123-44123 (2017-03-10)
Sorafenib is a RAF inhibitor approved for several cancers, including hepatocellular carcinoma (HCC). Inhibition of RAF kinases can induce a dose-dependent "paradoxical" upregulation of the downstream mitogen-activated protein kinase (MAPK) pathway in cancer cells. It is unknown whether "paradoxical" ERK
B Song et al.
European review for medical and pharmacological sciences, 22(11), 3333-3341 (2018-06-20)
Extracellular signal-regulated kinase (ERK)/mitogen activated protein kinase (MAPK) signaling pathway is widely involved in cell proliferation and invasion regulation. Enhanced expression or function of ERK1 is important for leukemia. Abnormal down-regulation of microRNA (miR)-143 is correlated with leukemia pathogenesis, indicating
Namal Perera et al.
International journal of biological sciences, 14(10), 1378-1388 (2018-08-21)
Antrodia cinnamomea (A. cinnamomea) is a medicinal fungus used in traditional Chinese medicine to treat different kinds of ailments, including liver diseases, abdominal pain, drug intoxication, diarrhea, itchy skin, hypertension, and cancer. Polysaccharides have been identified as one of the
Xuelian Li et al.
Scientific reports, 6, 37635-37635 (2016-11-24)
Although increases in cardiovascular load (pressure overload) are known to elicit ventricular remodeling including cardiomyocyte hypertrophy and interstitial fibrosis, the molecular mechanisms of pressure overload or AngII -induced cardiac interstitial fibrosis remain elusive. In this study, serpinE2/protease nexin-1 was over-expressed

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service