Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACGCTGCAACAAAGCAGATTTAGGACCAATAAGTCTTAATTGGTTTGAAGAACTTTCTTCAGAAGCTCCACCCTATAATTCTGAACCTGCAGAAGAATCTGAACATAAAAACAACAATTACGAACCAAACCTATTTAAAACTCCACAAAGGAAACCATCTTATAATCAGCTGGCTTCAACTCCAATAATATTCAAAGAGCAAGGGCTGACTCTGCCGCTGTACCAATCTCCTGTAAAAGAATTAGATAAATTCAAATTAGACTTAGGAAGGAATGTTCCCAATAGTAGACATAAAAGTCTTCGCACAGTGAAAACTAAAATGGATCAAGCAGATGATGTTTCCTGTCCACTTCTAAATTCTTGTCTTAGTGAAAGTCCTGTTGTTCTACAATGTACACATGTAACACCACAAAGAGATAAGTCAGTGGTATGTGGGAGTTTGTTTCATACACCAAAGTTTGTGAAGGGTCGTCAGACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Sukrit Mahajan et al.
The international journal of biochemistry & cell biology, 107, 128-139 (2018-12-28)
Cancer cells exhibit HR defects, increased proliferation and checkpoint aberrations. Tumour suppressor proteins, BRCA2 and p53 counteract such aberrant proliferation by checkpoint regulation. Intriguingly, chemo-resistant cancer cells, exhibiting mutated BRCA2 and p53 protein survive even with increased DNA damage accumulation.
Zihao Pan et al.
Annals of translational medicine, 7(23), 777-777 (2020-02-12)
Colon adenocarcinoma (CA) is the most common one with poor survival in colon cancer. This study aims to investigate the effect of miR-1245a on the process of CA cells and its target gene BRCA2. The expression of CA tissues and
Disulfiram's anti-cancer activity reflects targeting NPL4, not inhibition of aldehyde dehydrogenase.
Zdenek Skrott et al.
Oncogene, 38(40), 6711-6722 (2019-08-09)
Aldehyde dehydrogenase (ALDH) is a proposed biomarker and possible target to eradicate cancer stem cells. ALDH inhibition as a treatment approach is supported by anti-cancer effects of the alcohol-abuse drug disulfiram (DSF, Antabuse). Given that metabolic products of DSF, rather
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU031451-50UG | 04061831371611 |
| EHU031451-20UG | 04061831350791 |