Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCATTCCCTTCATTTCTCCTAAAAGATGGCAGAAGATTTTCAAGTCCCGGCTGGTGGAGTTGTTAGTGTCCTATGGCAACACCTTCTTTGTGGTTCTCATTGTCATCCTTGTGCTGTTGGTCATCGATGCCGTGCGCGAAATTCGGAAGTATGATGATGTGACGGAAAAGGTGAACCTCCAGAACAATCCCGGGGCCATGGAGCACTTCCACATGAAGCTTTTCCGTGCCCAGAGGAATCTCTACATTGCTGGCTTTTCCTTGCTGCTGTCCTTCCTGCTTAGACGCCTGGTGACTCTCATTTCGCAGCAGGCCACGCTGCTGGCCTCCAATGAAGCCTTTAAAAAGCAGGCGGAGAGTGCTAGTGAGGCGGCCAAGAAGTACATGGAGGAGAATGACCAGCTCAAGAAGGGAGCTGCTGTTGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Shuya Yang et al.
Frontiers in molecular biosciences, 7, 107-107 (2020-06-26)
Cervical cancer (CC) is the most common malignant tumor in gynecology, and metastasis is an important cause of patient death. MiRNAs (microRNAs) have been found to play key roles in cervical cancer metastasis, but the effect of miR-362-3p in CC
Shuya Yang et al.
Cancer medicine, 10(1), 305-316 (2020-11-20)
BAP31 (B-cell receptor-associated protein 31) is an important regulator of intracellular signal transduction and highly expressed in several cancer tissues or testicular tissues. Our previous study had revealed that elevated BAP31 plays a crucial role in the progress and metastasis
Kayo Machihara et al.
Cells, 8(11) (2019-11-02)
Cancer cells modulate their metabolism to proliferate and survive under the metabolic stress condition, which is known as endoplasmic reticulum (ER) stress. Therefore, cancer cells should suppress ER stress-mediated cell death and induce autophagy-which recycles metabolites to provide energy and
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU018291-20UG | 04061831339970 |
| EHU018291-50UG | 04061828330492 |