Skip to Content
Merck

EMU196641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkcc

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCACTCCACCTTTCAGACTCCGGACCGCCTGTATTTTGTGATGGAGTATGTCACTGGGGGCGATTTAATGTACCACATCCAGCAACTGGGCAAGTTTAAGGAGCCTCATGCAGCATTCTACGCTGCGGAAATCGCCATAGGCCTCTTCTTCCTTCACAACCAGGGCATCATCTACAGGGACCTCAAGTTGGATAATGTGATGCTGGATGCTGAAGGACACATCAAGATCACAGACTTTGGCATGTGTAAAGAGAATGTCTTCCCTGGGTCCACAACCCGCACCTTCTGTGGCACCCCAGACTACATAGCACCTGAGATCATTGCCTATCAGCCCTACGGGAAGTCTGTCGACTGGTGGTCTTTTGGGGTCCTGCTGTATGAGATGTTGGCAGGACAGCCACCCTTTGATGGGGAAGATGAGGAAGAGTTGTTTCAAGCCATCATGGAACAAACTGTCACCTATCCCAAGTCACTTTCCCGGGAAGCTGTGGCCATCTGCAAAGGGTTCCTGAC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sergio Carracedo et al.
BMC developmental biology, 13, 16-16 (2013-05-04)
Protein kinase C epsilon (PKCϵ) belongs to the novel PKC subfamily, which consists of diacylglycerol dependent- and calcium independent-PKCs. Previous studies have shown that PKCϵ is important in different contexts, such as wound healing or cancer. In this study, we
Sergio Carracedo et al.
BMC developmental biology, 13, 2-2 (2013-01-12)
The members of the protein kinase C (PKC) family consist of serine/threonine kinases classified according to their regulatory domain. Those that belong to the novel PKC subfamily, such as PKCδ, are dependent on diacylglycerol but not Calcium when considering their
Feng Chen et al.
PloS one, 9(7), e99823-e99823 (2014-07-16)
Gram positive (G+) infections make up ∼50% of all acute lung injury cases which are characterized by extensive permeability edema secondary to disruption of endothelial cell (EC) barrier integrity. A primary cause of increased permeability are cholesterol-dependent cytolysins (CDCs) of
Imene Jaadane et al.
Journal of cellular and molecular medicine, 19(7), 1646-1655 (2015-03-18)
Light-induced retinal degeneration is characterized by photoreceptor cell death. Many studies showed that photoreceptor demise is caspase-independent. In our laboratory we showed that leucocyte elastase inhibitor/LEI-derived DNase II (LEI/L-DNase II), a caspase-independent apoptotic pathway, is responsible for photoreceptor death. In
W Miklos et al.
Cancer letters, 361(1), 112-120 (2015-03-10)
Although triapine is promising for treatment of advanced leukemia, it failed against solid tumors due to widely unknown reasons. To address this issue, a new triapine-resistant cell line (SW480/tria) was generated by drug selection and investigated in this study. Notably

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service