Skip to Content
Merck

EMU090241

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hdac3

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTGGTAGAAGAGGCCATTAGTGAGGAACTTCCCTATAGTGAATACTTCGAGTACTTTGCCCCAGATTTCACACTCCATCCAGATGTCAGCACCCGCATCGAGAATCAGAACTCACGCCAGTATCTGGACCAGATCCGCCAGACAATCTTTGAAAACTTGAAGATGCTGAACCATGCACCCAGTGTCCAGATTCATGATGTCCCGGCAGACCTCCTGACGTATGACAGGACTGACGAGGCCGACGCTGAAGAGAGAGGTCCCGAGGAGAACTACAGCAGGCCAGAAGCACCCAATGAGTTCTATGATGGCGACCATGACAACGACAAGGAAAGTTGATGTGGAGATTTAGAGCAGCATGGATGCTGTGTCCCAAGAGTTCCTTGTCACCTCTGTGGTGGGAAGGAAAGTATGGTTTCCCCAGGTCTGAACTGGGTACCCCCAGGGTGTTTACTAACTCTGGTGAAGGGTTTGGAAACCATATGTGGTTCTAGAATTAACTCCCTTTCCTCAAACTCTCACGGCCTGATGATTGTCCCTCTCAGGGATGAGACATGGACA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Olga S Safronova et al.
Nucleic acids research, 42(14), 8954-8969 (2014-07-25)
Hypoxia is associated with a variety of physiological and pathological conditions and elicits specific transcriptional responses. The elongation competence of RNA Polymerase II is regulated by the positive transcription elongation factor b (P-TEFb)-dependent phosphorylation of Ser2 residues on its C-terminal
S S Roy et al.
Oncogene, 33(28), 3707-3716 (2013-08-27)
Tumor metastasis is the leading cause of death among breast cancer patients. PELP1 (proline, glutamic acid and leucine rich protein 1) is a nuclear receptor coregulator that is upregulated during breast cancer progression to metastasis and is an independent prognostic
Takuya Yashiro et al.
PloS one, 10(9), e0137699-e0137699 (2015-09-12)
The transcription factor PU.1 is predominantly expressed in dendritic cells (DCs) and is essential for DC differentiation. Although there are several reports that PU.1 positively regulates the expression of DC-specific genes, whether PU.1 also has a suppressive effect on DCs

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service