Skip to Content
Merck

EHU152641

Sigma-Aldrich

MISSION® esiRNA

targeting human LAIR1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGGAGACAAGAGCTGGAGACTGGAGGTTTCTAACCAGCATCCAGAAGGTTCGTTAGCCAGGTGGTCCCTTCTACAATCGAGCAGCTCCTTGGACAGACTGTTTCTCAGTTATTTCCAGAGACCCAGCTACAGTTCCCTGGCTGTTTCTAGAGACCCAGCTTTATTCACCTGACTGTTTCCAGAGACCCAGCTAAAGTCACCTGCCTGTTCTAAAGGCCCAGCTACAGCCAATCAGCCGATTTCCTGAGCAGTGATGCCACCTCCAAGCTTGTCCTAGGTGTCTGCTGTGAACCTCCAGTGACCCCAGAGACTTTGCTGTAATTATCTGCCCTGCTGACCCTAAAGACCTTCCTAGAAGTCAAGAGCTAGCCTTGAGACTGTGCTATACACACACAGCTGAGAGCCAAGCCCAGTTCTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ying Zhang et al.
Microbial pathogenesis, 109, 292-299 (2017-06-20)
Helicobacter pylori is a Gram-negative, microaerophilic bacteria usually found in the stomach, which may evade its host's immune system and present long-term symptoms in affected individuals. This study aimed to evaluate the functional role of leukocyte-associated immunoglobulin (Ig)-like receptor-1 (LAIR-1)
Guofeng Fan et al.
Frontiers in bioscience (Landmark edition), 24, 1050-1059 (2019-03-08)
Vascular remodeling is a critical event following a stroke. It is a well known fact that  C1q is the first molecule in the complement classical pathway. However, its role in the neovascularization that ocurs after a stroke, remains unclear. In
Chitra Joseph et al.
Cancers, 13(1) (2021-01-06)
The leukocyte-associated immunoglobulin-like receptor-1 (LAIR-1) plays a role in immune response homeostasis, extracellular matrix remodelling and it is overexpressed in many high-grade cancers. This study aimed to elucidate the biological and prognostic role of LAIR-1 in invasive breast cancer (BC).

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service