Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CACCAGCAAGCTAGATGCACTCCAACAAAGAGAACAACAGTTATTGGAATCTCTGGGGAACGGAACTGATTTTTCTGTTTCTAGCTCTGCATCAATGGATACCGTTACATCTTCTTCCTCTTCTAGCCTTTCAGTGCTACCTTCATCTCTTTCAGTTTTTCAAAATCCCACAGATGTGGCACGGAGCAACCCCAAGTCACCACAAAAACCTATCGTTAGAGTCTTCCTGCCCAACAAACAGAGGACAGTGGTACCTGCAAGGTGTGGAGTTACAGTCCGAGACAGTCTAAAGAAAGCACTGATGATGAGAGGTCTAATCCCAGAGTGCTGTGCTGTTTACAGAATTCAGGATGGAGAGAAGAAACCAATTGGTTGGGACACTGATATTTCCTGGCTTACTGGAGAAGAATTGCATGTGGAAGTGTTGGAGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Nicholes R Candelaria et al.
PloS one, 10(12), e0145061-e0145061 (2015-12-15)
Hereditary, hormonal, and behavioral factors contribute to the development of breast cancer. Alcohol consumption is a modifiable behavior that is linked to increased breast cancer risks and is associated with the development of hormone-dependent breast cancers as well as disease
Samantha K McCarty et al.
Endocrine-related cancer, 21(6), 865-877 (2014-09-18)
Increased p21-activated kinase (PAK) signaling and expression have been identified in the invasive fronts of aggressive papillary thyroid cancers (PTCs), including those with RET/PTC, BRAFV600E, and mutant RAS expression. Functionally, thyroid cancer cell motility in vitro is dependent on group
Xin Zhang et al.
The EMBO journal, 38(15), e100871-e100871 (2019-07-16)
Reactive oxygen species (ROS) are emerging as important regulators of cancer growth and metastatic spread. However, how cells integrate redox signals to affect cancer progression is not fully understood. Mitochondria are cellular redox hubs, which are highly regulated by interactions
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU127401-20UG | 04061831359855 |
| EHU127401-50UG | 04061831375305 |