Skip to Content
Merck

EHU105231

Sigma-Aldrich

MISSION® esiRNA

targeting human RPS3

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGAAGTTTGTCGCTGATGGCATCTTCAAAGCTGAACTGAATGAGTTTCTTACTCGGGAGCTGGCTGAAGATGGCTACTCTGGAGTTGAGGTGCGAGTTACACCAACCAGGACAGAAATCATTATCTTAGCCACCAGAACACAGAATGTTCTTGGTGAGAAGGGCCGGCGGATTCGGGAACTGACTGCTGTAGTTCAGAAGAGGTTTGGCTTTCCAGAGGGCAGTGTAGAGCTTTATGCTGAAAAGGTGGCCACTAGAGGTCTGTGTGCCATTGCCCAGGCAGAGTCTCTGCGTTACAAACTCCTAGGAGGGCTTGCTGTGCGGAGGGCCTGCTATGGTGTGCTGCGGTTCATCATGGAGAGTGGGGCCAAAGGCTGCGAGGTTGTGGTGTCTGGGAAACTCCGAGGACAGAGGGCTAAATCCATGAAGTTTGTGGATGGCCTGATGATCCACAGCGGAGACCCTGTTAACTACTACGTTGACACTGCTGTGCGCCACGTGTTGCTCAGACAGGGTGTGCTGGGCATCAAGGTGAAGATCATGCTGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Masanori Kobayashi et al.
Scientific reports, 6, 36780-36780 (2016-11-11)
Ubiquitination is a crucial post-translational modification; however, the functions of ubiquitin-coding genes remain unclear. UBA52 encodes a fusion protein comprising ubiquitin at the N-terminus and ribosomal protein L40 (RPL40) at the C-terminus. Here we showed that Uba52-deficient mice die during
Bhawana George et al.
Biochimica et biophysica acta, 1843(9), 1930-1941 (2014-05-28)
Skeletal muscle formation is a multistep process involving proliferation, differentiation, alignment and fusion of myoblasts to form myotubes which fuse with additional myoblast to form myofibers. Toca-1 (Transducer of Cdc42-dependent actin assembly), is an adaptor protein which activates N-WASP in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service