Skip to Content
Merck

EHU074041

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKAA1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTCAGAAGAGGAAGTTCTCAGCTGTCTTTACAACAGAAATCACCAGGATCCTTTGGCAGTTGCCTACCATCTCATAATAGATAACAGGAGAATAATGAATGAAGCCAAAGATTTCTATTTGGCGACAAGCCCACCTGATTCTTTTCTTGATGATCATCACCTGACTCGGCCCCATCCTGAAAGAGTACCATTCTTGGTTGCTGAAACACCAAGGGCACGCCATACCCTTGATGAATTAAATCCACAGAAATCCAAACACCAAGGTGTAAGGAAAGCAAAATGGCATTTAGGAATTAGAAGTCAAAGTCGACCAAATGATATTATGGCAGAAGTATGTAGAGCAATCAAACAATTGGATTATGAATGGAAGGTTGTAAACCCATATTATTTGCGTGTACGAAGGAAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cuiping Dai et al.
Oncotarget, 8(56), 95810-95823 (2017-12-10)
LB-100 is a novel PP2A inhibitor. Its activity in human colorectal cancer (CRC) cells was tested. The
Xue Han et al.
Oncogene, 38(38), 6537-6549 (2019-07-31)
Endometrial cancer (EC) is one of the most common gynecologic malignancies. However, the molecular mechanisms underlying the development and progression of EC remain unclear. Here, we demonstrated that the protein proviral insertion in murine lymphomas 2 (PIM2) was necessary for
Takuma Hashimoto et al.
Biochemical and biophysical research communications, 505(1), 13-19 (2018-09-19)
Solid tumors often contain hypoxic regions because an abnormal and inefficient tumor vasculature is unable to supply sufficient oxygen. Tissue hypoxia is generally defined as a low oxygen concentration of less than 2%. It is well known that tumor cells
Ying-Nan Wang et al.
Oncogene, 39(3), 637-650 (2019-09-19)
Patients with stage II or III colorectal cancer (CRC) exhibit various clinical outcomes after radical treatments. The 5-year survival rate was between 50 and 87%. However, the underlying mechanisms of the variation remain unclear. Here we show that AMPKα1 is
Javier Sáenz et al.
The Journal of nutritional biochemistry, 54, 48-56 (2017-12-16)
Liver X receptor alpha (LXRα) is a nuclear receptor involved in cholesterol homeostasis. Curcumin, a traditional Chinese derivative from the rhizomes of Curcuma longa and a well-known AMP-activated protein kinase (AMPK) activator, possess hypocholesterolemic activity, however, the possible link between

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service