Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAGATTCTGTCTGCTGTGGATTACTGTCATAGGCATATGGTTGTTCATCGAGACCTGAAACCAGAGAATGTCCTGTTGGATGCACACATGAATGCCAAGATAGCCGATTTCGGATTATCTAATATGATGTCAGATGGTGAATTTCTGAGAACTAGTTGCGGATCTCCAAATTATGCAGCACCTGAAGTCATCTCAGGCAGATTGTATGCAGGTCCTGAAGTTGATATCTGGAGCTGTGGTGTTATCTTGTATGCTCTTCTTTGTGGCACCCTCCCATTTGATGATGAGCATGTACCTACGTTATTTAAGAAGATCCGAGGGGGTGTCTTTTATATCCCAGAATATCTCAATCGTTCTGTCGCCACTCTCCTGATGCATATGCTGCAGGTTGACCCACTGAAACGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Lin Lin et al.
Frontiers in pharmacology, 10, 1617-1617 (2020-02-13)
The increase of blood pressure accelerates endothelial progenitor cells (EPCs) senescence, hence a significant reduction in the number of EPCs is common in patients with hypertension. Autophagy is a defense and stress regulation mechanism to assist cell homeostasis and organelle
Meera Saxena et al.
Journal of cell science, 131(14) (2018-06-29)
The developmental programme of epithelial-mesenchymal transition (EMT), involving loss of epithelial and acquisition of mesenchymal properties, plays an important role in the invasion-metastasis cascade of cancer cells. In the present study, we show that activation of AMP-activated protein kinase (AMPK)
Manipa Saha et al.
Cancer research, 78(6), 1497-1510 (2018-01-18)
Cell detachment from the extracellular matrix triggers anoikis. Disseminated tumor cells must adapt to survive matrix deprivation, while still retaining the ability to attach at secondary sites and reinitiate cell division. In this study, we elucidate mechanisms that enable reversible
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU042081-20UG | 04061831342208 |
| EHU042081-50UG | 04061831362527 |