Skip to Content
Merck

EHU034121

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKCG

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAAGGACGTGATCGTCCAGGACGACGATGTGGACTGCACGCTGGTGGAGAAACGTGTGCTGGCGCTGGGGGGCCGGGGTCCTGGCGGCCGGCCCCACTTCCTCACCCAGCTCCACTCCACCTTCCAGACCCCGGACCGCCTGTATTTCGTGATGGAGTACGTCACCGGGGGAGACTTGATGTACCACATTCAACAGCTGGGCAAGTTTAAGGAGCCCCATGCAGCGTTCTACGCGGCAGAAATCGCTATCGGCCTCTTCTTCCTTCACAATCAGGGCATCATCTACAGGGACCTGAAGCTGGACAATGTGATGCTGGATGCTGAGGGACACATCAAGATCACTGACTTTGGCATGTGTAAGGAGAACGTCTTCCCCGGGACGACAACCCGCACCTTCTGCGGGACCCCGGACTACATAGCCCCGGAGATCATTGCCTACCAGCCCTATGGGAAGTCTGTCGATTGGTGGTCCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sylvain Carras et al.
Journal of leukocyte biology, 99(2), 311-319 (2015-09-04)
M-CSF and G-CSF are instructive cytokines that specifically induce differentiation of bipotent myeloid progenitors into macrophages and granulocytes, respectively. Through morphology and colony assay studies, flow cytometry analysis of specific markers, and expression of myeloid transcription factors, we show here
Juan Carlos Montero et al.
Oncotarget, 7(47), 77937-77949 (2016-10-28)
P-Rex proteins are guanine nucleotide exchange factors (GEFs) that act on the Rho/Rac family of GTP binding proteins. The activity of P-Rex proteins is regulated by several extracellular stimuli. In fact, activation of growth factor receptors has been reported to
Tianchao Yu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 395-402 (2016-09-27)
Application of general anesthetics may induce neurotoxicity in dorsal root ganglia (DRG) neurons. In this study, we examined the possible protective mechanism and associated signaling pathways of small-molecule glycogen synthase kinase-3 (GSK-3) inhibitor, SB216763, in bupivacaine-injured mouse DRG neurons in
Yoon Kyung Choi
Archives of pharmacal research, 40(12), 1433-1442 (2017-10-13)
Treatment of human retinal microvascular endothelial cells (HRMECs) with vascular endothelial growth factor 165 (VEGF
Feng Chen et al.
PloS one, 9(7), e99823-e99823 (2014-07-16)
Gram positive (G+) infections make up ∼50% of all acute lung injury cases which are characterized by extensive permeability edema secondary to disruption of endothelial cell (EC) barrier integrity. A primary cause of increased permeability are cholesterol-dependent cytolysins (CDCs) of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service