Skip to Content
Merck

EHU018151

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF1

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCACTACCGGAAACACACGGGGCAGCGCCCCTTCCGCTGCCAGCTCTGCCCACGTGCTTTTTCGCGCTCTGACCACCTGGCCTTGCACATGAAGCGCCACCTTTGAGCCCTGCCCTGGCACTTGGACTCTCCTAGTGACTGGGGATGGGACAAGAAGCCTGTTTGGTGGTCTCTTCACACGGACGCGCGTGACACAATGCTGGGTGGTTTTCCCACGAATGGACCCTCTCCTGGACTCGCGTTCCCAAAGATCCACCCAAATATCAAACACGGACCCATAGACAGCCCTGGGGGAGCCTCTTACGGAAAATCCGACAAGCCTTCAGCCACAGGGAGCCACACAGAGATGTCCAAACTGTCGTGCAAACCCAGTGAGACAGACCGCCAAATAAACGGACTCAGTGGACACTCAGACCAGCTCCCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Petros Papadopoulos et al.
Human genomics, 14(1), 39-39 (2020-10-18)
The expression of the human β-like globin genes follows a well-orchestrated developmental pattern, undergoing two essential switches, the first one during the first weeks of gestation (ε to γ), and the second one during the perinatal period (γ to β).
Mark A Gillespie et al.
Molecular cell, 78(5), 960-974 (2020-04-25)
Dynamic cellular processes such as differentiation are driven by changes in the abundances of transcription factors (TFs). However, despite years of studies, our knowledge about the protein copy number of TFs in the nucleus is limited. Here, by determining the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service