Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTCCTCGGCTGCAGATTAACTGCGCCTATTTCACCACCATTGCAAGGCCAACTATGGACAGCAAGAAGAACCTGGAGATTTGGGGTATCAAGTGCCGACTGACTCTGCAAAAGCCCAGTTGTCTATGAAGTGCTTACCGCAGAGCGGTGTTTCCTCTGGAACGAGGAAAGCAGGCAGCAAGTCCGCATGCTGGAGACCTTGGTTACTCTTCCTATTGGCTTTGCCTTAGCCTTCACTTTATATGTATGTTAGGGAACCATTTGCGAGGGGGACAGCCACGAAGTGTTACTTTTTCAAAACTATAGAGCCGATTCTGTCAGTGCTGTGCCCTAAGGGCCTAAGCGGCAGGTCTTTGGAGATTTTAGGAGAGCCTATGATTTCAGCATGCTTTTTTAAAAGCGACATTTGAGCCAAC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... SKP2(27401), Skp2(27401)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Haijin Chen et al.
Molecular medicine reports, 10(2), 1129-1135 (2014-06-11)
Colon cancer is a common type of malignancy in the digestive system. The aim of the present study was to investigate the role of S-phase kinase-associated protein 2 (Skp2) in colon carcinoma and to identify whether depletion of Skp2 by Skp2‑RNA interference
Ming Qi et al.
Molecular medicine reports, 11(5), 3934-3940 (2015-01-13)
In order to determine the protein expression of S‑phase kinase‑associated protein 2 (Skp2) and p27kip1, and to evaluate their possible prognostic values in malignant liver cancer, tissue samples from 50 patients and 40 controls were assessed and analyzed by immunohistochemistry
Wenfu Lu et al.
Oncotarget, 6(2), 771-788 (2015-01-19)
Aberrant elevation of JARID1B and histone H3 lysine 4 trimethylation (H3K4me3) is frequently observed in many diseases including prostate cancer (PCa), yet the mechanisms on the regulation of JARID1B and H3K4me3 through epigenetic alterations still remain poorly understood. Here we
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU065851-20UG | 04061831339017 |
| EMU065851-50UG | 04061828249923 |