Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCCAGTTTATGGTTTCCAATGGAGGCATTTTGGAGCAGAGTACAAAGATATGGATTCAGATTACTCGGGACAAGGAGTAGACCAGCTGCAAAAAGTGATTGACACCATCAAAACCAACCCTGATGACAGAAGAATCATCATGTGTGCCTGGAACCCAAAAGATCTTCCCCTGATGGCACTGCCTCCTTGCCATGCCCTCTGTCAGTTCTATGTGGTGAATGGGGAACTGTCTTGCCAGCTTTACCAGAGGTCAGGAGATATGGGTCTGGGCGTGCCCTTCAACATTGCCAGCTATGCTCTGCTCACCTACATGATTGCACATATCACAGGCCTGCAGCCAGGTGATTTTGTCCACACTTTGGGAGATGCACATATTTACCTGAATCATATAGAGCCGCTGAAAATTCAGCTACAGCGAGAACCAAGACCTTTCCCAAAGC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... TYMS(22171), Tyms(22171)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hoe-Su Jeong et al.
Biochimica et biophysica acta, 1849(6), 709-721 (2015-03-01)
The ubiquitin-proteasome system (UPS) plays an important role in protein quality control, cellular signalings, and cell differentiation through the regulated turnover of key transcription factors in cardiac tissue. However, the molecular mechanism underlying Fbxo25-mediated ubiquitination of cardiac transcription factors remains
Dan Yang et al.
Cancer chemotherapy and pharmacology, 76(3), 575-586 (2015-07-26)
5-Fluorouracil (5-FU) is the basic chemotherapeutic agent used to treat colon cancer. However, the sensitivity of colon cancer cells to 5-FU is limited. Gossypol is a polyphenolic extract of cottonseeds. The purpose of this study was to investigate the activities
P Svenningsen et al.
Acta physiologica (Oxford, England), 212(2), 166-174 (2014-06-11)
In the renal collecting ducts, ATP stimulates a Ca(2+) -activated chloride current. The identity of the channel responsible for the current under physiological conditions is not known and it was hypothesized that TMEM16a is a relevant candidate in the renal
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU020171-50UG | 04061828278794 |
| EMU020171-20UG | 04061828504008 |