Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AATGCCCTGGTAATGTCTGCATTCAACAATGACGCTGGCTTTGTGGCTGCTCTTGATAAGGCTTGTGGTCGCTTCATAAACAACAACGCGGTTACCAAGATGGCCCAATCATCCAGTAAATCCCCTGAGTTGCTGGCTCGATACTGTGACTCCTTGTTGAAGAAAAGTTCCAAGAACCCAGAGGAGGCAGAACTAGAAGACACACTCAATCAAGTGATGGTTGTCTTCAAGTACATAGAAGACAAAGACGTATTTCAGAAGTTCTATGCGAAGATGCTCGCCAAGAGGCTCGTCCACCAGAACAGTGCAAGTGACGATGCCGAAGCCAGCATGATCTCCAAGTTAAAGCAAGCTTGCGGGTTCGAGTACACCTCTAAACTTCAGCGCATGTTTCAAGACATTGGCGTGAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yan Zhou et al.
BMC cancer, 16(1), 818-818 (2016-10-23)
Triple-negative breast cancer (TNBC) has aggressive progression with poor prognosis and ineffective treatments. Selumetinib is an allosteric, ATP-noncompetitive inhibitor of MEK1/2, which has benn known as effective antineoplastic drugs for several malignant tumors. We hypothesized that Selumetinib might be potential
Ye-Fei Huang et al.
Cell death & disease, 10(1), 2-2 (2018-12-24)
CUL1 is an essential component of SCF (SKP1-CUL1-F-box protein) E3 ubiquitin ligase complex. Our previous study has showed that CUL1 is positively associated with poor overall and disease-specific survival of breast cancer patients. Here, we further explored its roles in
Yue-Chao Fan et al.
Medical oncology (Northwood, London, England), 31(10), 227-227 (2014-09-10)
This study was designed to explore the role of Cullin1 (Cul1) in the pathogenesis of human glioma and to investigate the role of Cul1 in the growth, migration and invasion of glioma cells. Expression of Cul1 in 191 glioma tissues
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU070971-20UG | 04061831352450 |
| EHU070971-50UG | 04061828370962 |