Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCTGTGGGCCTGACTACTACGAAGTGGAAGAAGATGGCATCCGCAAGTGTAAAAAATGTGATGGGCCCTGTCGCAAAGTTTGTAATGGCATAGGCATTGGTGAATTTAAAGACACACTCTCCATAAATGCTACAAACATCAAACACTTCAAATACTGCACTGCCATCAGCGGGGACCTTCACATCCTGCCAGTGGCCTTTAAGGGGGATTCTTTCACGCGCACTCCTCCTCTAGACCCACGAGAACTAGAAATTCTAAAAACCGTAAAGGAAATAACAGGCTTTTTGCTGATTCAGGCTTGGCCTGATAACTGGACTGACCTCCATGCTTTCGAGAACCTAGAAATAATACGTGGCAGAACAAAGCAACATGGTCAGTTTTCTTTGGCGGTCGTTGGCCTGAACATCACATCACTGGGGCTGCGTTCCCTCAAGGAGATCAG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... EGFR(13649), Egfr(13649)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ijeoma Adaku Umelo et al.
Lung cancer (Amsterdam, Netherlands), 90(2), 167-174 (2015-09-08)
Lung cancer remains the leading cause of cancer-related mortality worldwide, with metastatic disease frequently a prominent feature at the time of diagnosis. The role of NSCLC-derived EGFR mutations in cancer cell proliferation and survival has been widely reported, but little
Began Gopalan et al.
Biomaterials, 35(26), 7479-7487 (2014-06-11)
Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed lethal cancers in the world. We previously showed two imidazolium salts (IBN-1 and IBN-9) with a moderate efficacy for HCC. Here we report a more potent imidazolium compound IBN-65 (1-benzyl-2-phenyl-3-(4-isopropyl)-benzyl-imidazolium
Yong Bian et al.
Biochemical and biophysical research communications, 463(4), 612-617 (2015-06-06)
Lipid metabolism is dysregulated in many human diseases including atherosclerosis, type 2 diabetes and cancers. Fatty acid synthase (FASN), a key lipogenic enzyme involved in de novo lipid biosynthesis, is significantly upregulated in multiple types of human cancers and associates
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU075311-50UG | 04061828294923 |
| EMU075311-20UG | 04061828523689 |