Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TACCTGCAGCAGCACAACATCCCACAGCGGGAGGTGGTCGATACCACTGGCCTCAACCAGTCCCACCTGTCCCAACACCTCAACAAGGGCACTCCCATGAAGACGCAGAAGCGGGCCGCCCTGTACACCTGGTACGTCCGCAAGCAGCGAGAGGTGGCGCAGCAGTTCACCCATGCAGGGCAGGGAGGGCTGATTGAAGAGCCCACAGGTGATGAGCTACCAACCAAGAAGGGGCGGAGGAACCGTTTCAAGTGGGGCCCAGCATCCCAGCAGATCCTGTTCCAGGCCTATGAGAGGCAGAAGAACCCTAGCAAGGAGGAGCGAGAGACGCTAGTGGAGGAGTGCAATAGGGCGGAATGCATCCAGAGAGGGGTGTCCCCATCACAGGCACAGGGGCTGGGCTCCAACCTCGTCACGGAGGTGCGTGTCTACAACTGGTTTGCCAACC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ethan V Abel et al.
eLife, 7 (2018-08-04)
The biological properties of pancreatic cancer stem cells (PCSCs) remain incompletely defined and the central regulators are unknown. By bioinformatic analysis of a human PCSC-enriched gene signature, we identified the transcription factor HNF1A as a putative central regulator of PCSC
Oğuzhan Fatih Baltacı et al.
Turkish journal of medical sciences, 48(3), 620-627 (2018-06-20)
Background/aim: MODY3 associated with HNF1A is the most common form of MODY and is clinically misdiagnosed as type 1 diabetes due to similar clinical symptoms. This study aimed to analyze the role of HNF1A-regulated miRNAs as a biomarker in the
Shipra Shukla et al.
Cancer cell, 32(6), 792-806 (2017-11-21)
Prostate cancer exhibits a lineage-specific dependence on androgen signaling. Castration resistance involves reactivation of androgen signaling or activation of alternative lineage programs to bypass androgen requirement. We describe an aberrant gastrointestinal-lineage transcriptome expressed in ∼5% of primary prostate cancer that
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU146271-20UG | 04061828651849 |
| EHU146271-50UG | 04061828426423 |