Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderdescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGTGATTTTGCTTGCCTGATGTTCAAACACCTGGTACACAAACCATCGGAGGAGAGAGTAAGAGAAATAATTATCAATGCTGTTCGGATAGAACAGGAGTTCCTCACTGAGGCCTTGCCTGTGAAGCTCATTGGGATGAATTGCACTCTAATGAAGCAATACATTGAGTTTGTGGCAGACAGACTTATGCTGGAACTGGGTTTTAGCAAGGTTTTCAGAGTAGAGAACCCATTTGACTTTATGGAGAATATTTCACTGGAAGGAAAGACTAACTTCTTTGAGAAGAGAGTAGGCGAGTATCAGAGGATGGGAGTGATGTCAAGTCCAACAGAGAATTCTTTTACCTTGGATGCTGACTTCTAAATGAACTGAAGATGTGCCCTTACTTGGCTGATTTTTTTTTTCCATCTCATAAGAAAAATCAGCTGAAGTGTTACCAACTAGCCACACCATGAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Yueting Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 103, 982-988 (2018-05-02)
Peripheral vascular disease (PVD) is a prevalent vascular disease that affect a large number of patients. The establishment of optimal treatments to mitigate the intimal hyperplasia (IH)-induced restenosis would help relieve the health burden of the PVD. Ribonucleotide reductase M2
S M Du
Neoplasma, 67(3), 567-575 (2020-03-04)
Long noncoding RNAs (lncRNAs) have been suggested to play vital roles in tumor initiation and progression. Recent studies have reported that the lncRNA small nucleolar RNA host gene 16 (SNHG16) is highly expressed in breast cancer tissue. In the present
Zejun Fang et al.
Oncotarget, 7(47), 78055-78068 (2016-11-02)
As the small subunit of Ribonucleotide reductase (RR), RRM2 displays a very important role in various critical cellular processes such as cell proliferation, DNA repair, and senescence, etc. Importantly, RRM2 functions like a tumor driver in most types of cancer
Numéro d'article de commerce international
| Référence | GTIN |
|---|---|
| EHU121701-20UG | 04061828582259 |
| EHU121701-50UG | 04061828347476 |