Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderdescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGTCATCGTCTCCAACTTCAACTACTTCTACCACCGGGAAACGGATCACGAGGAGCCGGCAGTCCTTAAGGAAGAGCAGGGCACTCAGAGCCAGGGGCCGGGGCTGGACAGAGGAGTCCAGCGGAAGGTCAGCGGGAGCAGGGGATCCTTCTGCAAGGCTGGGGGGACCCTGGAGAATGCAGACAGTGCCCGAAGGGGCAGCTGCCCCCTAGAGAAGTGTAACGTCAAGGCCAAGAGCAACGTGGACTTGCGGAGGTCCCTTTATGCCCTCTGCCTGGACACCAGCCGGGAAACAGATTTGTGAAAGGAGATTCAGGCAGACTGGTGGCAGTGGAGTAGGGAATGGGAGGCTTGCTGAACATGGATATCTACATTATACCGCAGAGTATTTGAAGTCACACTGTAACCTCAGTCTACCCCTCTCCTTTCACTCCTTTCCTCCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Jie-Yi Du et al.
Life sciences, 168, 28-37 (2016-01-15)
Palmitate, a common saturated free fatty acid, induces endothelial apoptosis in vitro in culture endothelial cells and in vivo in type 2 diabetes mellitus (T2DM) patients. The present study aimed to investigate whether Kv1.5 regulates palmitate-induced endothelial apoptosis and endothelial
Baobiao Zhuo et al.
Biochemical and biophysical research communications, 464(2), 401-406 (2015-06-28)
Accumulating evidence has shown that PI3K/Akt pathway is frequently hyperactivated in osteosarcoma (OS) and contributes to tumor initiation and progression. Altered phenotype of glucose metabolism is a key hallmark of cancer cells including OS. However, the relationship between PI3K/Akt pathway
Numéro d'article de commerce international
| Référence | GTIN |
|---|---|
| EHU118431-20UG | 04061828552399 |
| EHU118431-50UG | 04061828316977 |