Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderdescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCTACTGTGATGTGAAATGCTCATACTTTATAAGTAATTCTATGCAAAATCATAGCCAAAACTAGTATAGAAAATAATACGAAACTTTAAAAAGCATTGGAGTGTCAGTATGTTGAATCAGTAGTTTCACTTTAACTGTAAACAATTTCTTAGGACACCATTTGGGCTAGTTTCTGTGTAAGTGTAAATACTACAAAAACTTATTTATACTGTTCTTATGTCATTTGTTATATTCATAGATTTATATGATGATATGACATCTGGCTAAAAAGAAATTATTGCAAAACTAACCACTATGTACTTTTTTATAAATACTGTATGGACAAAAAATGGCATTTTTTATATTAAATTGTTTAGCTCTGGCAAAAA
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... NFE2L2(4780), AC079305.6-201(4780)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Valentina Gambardella et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(5), 1639-1649 (2018-12-07)
Despite the clinical advantage of the combination of trastuzumab and platinum-based chemotherapy in HER2-amplified tumors, resistance will eventually develop. The identification of molecular mechanisms related to primary and acquired resistance is needed. We generated lapatinib- and trastuzumab-resistant clones deriving from
Numéro d'article de commerce international
| Référence | GTIN |
|---|---|
| EHU093471-20UG | 04061831356182 |
| EHU093471-50UG | 04061828363117 |