Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderdescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCAATAAAGATCGCCTGAATTCTGCTATTATCTATGACCGAGATTTCTCTTACAATTACTTCGGCTTTAAGACGCTAGAGCGGTCTTATTTGTTGAAGATCAATGGAAAAGTGGCTGAAAGACCACAACATATGTTGATGAGAGTATCTGTTGGGATCCACAAAGAAGACATTGATGCAGCAATTGAAACATATAATCTTCTTTCTGAGAGGTGGTTTACTCATGCTTCGCCCACTCTCTTCAATGCTGGTACCAACCGCCCACAACTTTCTAGCTGTTTTCTTCTGAGTATGAAAGATGACAGCATTGAAGGCATTTATGACACTCTAAAGCAATGTGCATTGATTTCTAAGTCTGCTGGAGGAATTGGTGTTGCTGTGAGTTGTATTCGGGCTACTGGCAGCTACATTGCTGGGACTAATGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Zarah Glad Zimling et al.
Anticancer research, 35(12), 6731-6738 (2015-12-08)
A possible predictive impact of ribonucleotide-reductase subunit-1 (RRM1) on vinorelbine efficacy in non-small cell lung cancer (NSCLC) has been previously reported. The present study aimed to further explore this finding in malignant pleural mesothelioma (MPM). Seventy-one patients with MPM receiving
Ribonucleotide Reductase Catalytic Subunit M1 (RRM1) as a Novel Therapeutic Target in Multiple Myeloma.
Morihiko Sagawa et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 23(17), 5225-5237 (2017-04-27)
Rong Yao et al.
PloS one, 10(5), e0125169-e0125169 (2015-05-07)
Pulmonary fibrosis is one of the most common complications of paraquat (PQ) poisoning, which demands for more effective therapies. Accumulating evidence suggests adiponectin (APN) may be a promising therapy against fibrotic diseases. In the current study, we determine whether the
Numéro d'article de commerce international
| Référence | GTIN |
|---|---|
| EHU017091-20UG | 04061831339758 |
| EHU017091-50UG | 04061828339679 |