Se connecter pour consulter les tarifs organisationnels et contractuels.
Sélectionner une taille de conditionnement
Changer de vue
A propos de cet article
NACRES:
NA.51
UNSPSC Code:
41105324
Service technique
Besoin d'aide ? Notre équipe de scientifiques expérimentés est là pour vous.
Laissez-nous vous aiderdescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTTGGTGTCTGGCAGTCTCATTCAGAATGGACATTCCTGCCACAAGGTTGCAGTAGTGAGAGAAGATAAATTGGAAGCAGTGAAGTCCAAGCTAGCTGTGACTGCCAGCATCCATGTGTACAGCATCCAGAAAGCCATGCTAAAGGACAGTGGGCCTCTGTTCAATACTGACTATGACATCCTTAAAAGCAACTTGCAGAACTGCAGCAAATTTAGTGCTATACAATGTGCAGCTGCCGTCCCTAGAGCTCCTGCTGAATCCTCTTCGTCTTCCAAAAAGTTTGAGCAGTCACATCTTCACATGTCAAGTGAGACACAAGCCAACAATGAGCTGACCACCAATGGTCATGGCCCACCTGCATCCAAGCAGGTTTCCCAGCAGCCCAAAGGAATTATGGGAATGTTTGCCTCCAAAGCTGCTGCTAAAACC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Classe de stockage
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Emanuela Tumini et al.
Scientific reports, 6, 38873-38873 (2016-12-16)
DNA replication is essential for cellular proliferation. If improperly controlled it can constitute a major source of genome instability, frequently associated with cancer and aging. POLD1 is the catalytic subunit and POLD3 is an accessory subunit of the replicative Pol
Xianning Lai et al.
Nature communications, 8, 15983-15983 (2017-07-18)
Failure to restart replication forks stalled at genomic regions that are difficult to replicate or contain endogenous DNA lesions is a hallmark of BRCA2 deficiency. The nucleolytic activity of MUS81 endonuclease is required for replication fork restart under replication stress
Robert L Dilley et al.
Nature, 539(7627), 54-58 (2016-11-04)
Homology-directed DNA repair is essential for genome maintenance through templated DNA synthesis. Alternative lengthening of telomeres (ALT) necessitates homology-directed DNA repair to maintain telomeres in about 10-15% of human cancers. How DNA damage induces assembly and execution of a DNA
Numéro d'article de commerce international
| Référence | GTIN |
|---|---|
| EHU012621-20UG | 04061828674565 |
| EHU012621-50UG | 04061828448968 |