Skip to Content
Merck

EHU094331

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK11

Sign Into View Organizational & Contract Pricing

Select a Size


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACGTCCATCGAGGACTTCAGCGAAGTGTACTTGGTGACCACCCTGATGGGCGCCGACCTGAACAACATCGTCAAGTGCCAGGCGCTGAGCGACGAGCACGTTCAATTCCTGGTTTACCAGCTGCTGCGCGGGCTGAAGTACATCCACTCGGCCGGGATCATCCACCGGGACCTGAAGCCCAGCAACGTGGCTGTGAACGAGGACTGTGAGCTCAGGATCCTGGATTTTGGGCTGGCGCGCCAGGCGGACGAGGAGATGACCGGCTATGTGGCCACGCGCTGGTACCGGGCACCTGAGATCATGCTCAACTGGATGCATTACAACCAAACAGTGGATATCTGGTCCGTGGGCTGCATCATGGCTGAGCTGCTCCAGGGCAAGGCCCTCTTCCCGGGAAGCGACTACATTGACCAGCTGAAGCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaoyu Zhang et al.
Antiviral research, 167, 68-77 (2019-04-07)
Lassa virus (LASV) causes Lassa hemorrhagic fever in humans and poses a significant threat to public health in West Africa. Current therapeutic treatments for Lassa fever are limited, making the development of novel countermeasures an urgent priority. In this study
A J Browne et al.
Cell death & disease, 7, e2119-e2119 (2016-02-26)
The Wnt inhibitor Dickkopf-1 (DKK-1) has been associated with the occurrence of bone metastases in osteotropic prostate cancer by inhibiting osteoblastogenesis. P38 mitogen-activated protein kinase (MAPK) activity is also dysregulated in advanced prostate cancer. However, the impact of p38 MAPK

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service