콘텐츠로 건너뛰기
Merck

EMU050591

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Socs3

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GACCTCTCTCCTCCAACGTGGCCACCCTCCAGCATCTTTGTCGGAAGACTGTCAACGGCCACCTGGACTCCTATGAGAAAGTGACCCAGCTGCCTGGACCCATTCGGGAGTTCCTGGATCAGTATGATGCTCCACTTTAAGGAGCAAAAGGGTCAGAGGGGGGCCTGGGTCGGTCGGTCGCCTCTCCTCCGAGGCACATGGCACAAGCACAAAAATCCAGCCCCAACGGTCGGTAGCTCCCAGTGAGCCAGGGGCAGATTGGCTTCTTCCTCAGGCCCTCCACTCCCGCAGAGTAGAGCTGGCAGGACCTGGAATTCGTCTGAGGGGAGGGGGAGCTGCCACCTGCTTTCCCCCCTCCCCCAGCTCCAGCTTCTTTCAAGTGGAGCCAGCCGGCCTGGCCTGGTGGGACAATACCTTTGACAAGCGGACTCTCC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Shusheng Che et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 6805-6811 (2015-04-05)
Malignant glioma is the most common intracranial tumor with poor prognosis. It is well believed that glioma stem cells (GSCs) are responsible for the initiation and progression of glioma. Janus kinase/signal transducer and activator of transcription (Jak/STAT3) pathway plays a
Gang Xu et al.
Virology, 462-463, 343-350 (2014-07-16)
MiR-221 was reported to be upregulated and play roles in tumorigenesis of hepatitis C virus (HCV) associated hepatocellular carcinoma (HCC). However, the role of miR-221 in HCV infection remains unknown. In this study, it was found that miR-221 was upregulated
E-J Choi et al.
Scandinavian journal of immunology, 82(4), 337-344 (2015-06-16)
Varicella-zoster virus (VZV) is an important viral pathogen that is responsible for causing varicella (chickenpox) and herpes zoster (shingles). VZV has been shown to suppress early anti-viral innate immune responses, but the exact mechanisms are not yet well understood. Here
Whajung Cho et al.
Journal of immunology (Baltimore, Md. : 1950), 194(9), 4287-4297 (2015-04-01)
PGs are emerging as important immune modulators. Since our report on the expression of PG synthases in human follicular dendritic cells, we investigated the potential immunoregulatory function of PGs and their production mechanisms. In this study, we explored the intracellular
Andrea Heldsinger et al.
Endocrinology, 155(10), 3956-3969 (2014-07-26)
The anorexigenic adipocyte-derived hormone leptin and the orexigenic hormone ghrelin act in opposition to regulate feeding behavior via the vagal afferent pathways. The mechanisms by which ghrelin exerts its inhibitory effects on leptin are unknown. We hypothesized that ghrelin activates

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.