콘텐츠로 건너뛰기
Merck

EHU144411

Sigma-Aldrich

MISSION® esiRNA

targeting human ARF1

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCTTAAGCTGGGTGAGATCGTGACCACCATTCCCACCATAGGCTTCAACGTGGAAACCGTGGAGTACAAGAACATCAGCTTCACTGTGTGGGACGTGGGTGGCCAGGACAAGATCCGGCCCCTGTGGCGCCACTACTTCCAGAACACACAAGGCCTGATCTTCGTGGTGGACAGCAATGACAGAGAGCGTGTGAACGAGGCCCGTGAGGAGCTCATGAGGATGCTGGCCGAGGACGAGCTCCGGGATGCTGTCCTCCTGGTGTTCGCCAACAAGCAGGACCTCCCCAACGCCATGAATGCGGCCGAGATCACAGACAAGCTGGGGCTGCACTCACTACGCCACAGGAACTGGTACATTCAGGCCACCTGCGCCACCAGCGGCGACGGGCTCTATGAAGGACTGGACTGGCTGTCCAATCAGCTCCGGAACCAGAAGTGAACGCGACCCCCCTCCCTCTCACTCCTCTTGCCCTCTGCTTTA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ARF1(375), ARF1(375)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Nisha Bte Mohd Rafiq et al.
The Journal of cell biology, 216(1), 181-197 (2016-12-23)
Podosomes represent a class of integrin-mediated cell-matrix adhesions formed by migrating and matrix-degrading cells. We demonstrate that in macrophage-like THP1 cells and fibroblasts stimulated to produce podosomes, down-regulation of the G-protein ARF1 or the ARF1 guanine nucleotide exchange factor, ARNO
Tatsuyuki Matsudaira et al.
Journal of cell science, 128(16), 3131-3142 (2015-07-03)
The retrograde pathway is defined by the transport of proteins and lipids from the plasma membrane through endosomes to the Golgi complex, and is essential for a variety of cellular activities. Recycling endosomes are important sorting stations for some retrograde
Christin Münzberg et al.
Journal of cellular and molecular medicine, 19(5), 948-959 (2015-03-11)
Hypersecretion is the major symptom of functional neuroendocrine tumours. The mechanisms that contribute to this excessive secretion of hormones are still elusive. A key event in secretion is the exit of secretory products from the Golgi apparatus. ADP-ribosylation factor (Arf)

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.