설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AGCCAAAATCAGAGCTGGAACCTGAGGAGAGAGTGTTCAAGAAGGAAGTGTATCTTCATACATCACCACACCTGAAAGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGAGATGGCAGCTGAGTCATTGCCTTTCTCCTTCGGGACACTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGACCTGCAAGAGGTCCTGTCTTCAGATGAAAATGGGGGTACCTATGTTTCACCTCCTGGAAATGAAGAGGAAGAATCAAAAATCTTCACCACTCTTGACCCTGCTTCTCTGGCTTGGCTGACTGAGGAGGAGCCAGAACCAGCAGAGGTCACAAGCACCTCCCAGAGCCCTCACTCTCCAGATTCCAGTCAGAGCTCCCTGGCTCAGGAGGAAGAGGAGGAAGACCAAGGGAGAACCAGGAAACGGAAACAGAGTGGTCATTCCCCAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... DDIT3(1649), DDIT3(1649)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Maulasri Bhatta et al.
Cell death & disease, 9(5), 467-467 (2018-04-28)
Persistent vascular injury and degeneration in diabetes are attributed in part to defective reparatory function of angiogenic cells. Our recent work implicates endoplasmic reticulum (ER) stress in high-glucose-induced bone marrow (BM) progenitor dysfunction. Herein, we investigated the in vivo role
Ahmed A Gafar et al.
PeerJ, 4, e2445-e2445 (2016-11-30)
Lithocholic acid (LCA) is a secondary bile acid that is selectively toxic to human neuroblastoma, breast and prostate cancer cells, whilst sparing normal cells. We previously reported that LCA inhibited cell viability and proliferation and induced apoptosis and necrosis of
Lu Fan et al.
Frontiers in pharmacology, 8, 424-424 (2017-07-15)
Hepatocellular carcinoma (HCC) is a malignant primary liver cancer with poor prognosis. In the present study, we report that pekinenin E (PE), a casbane diterpenoid derived from the roots of
Bin Fang et al.
International journal of biological sciences, 14(10), 1221-1231 (2018-08-21)
Purpose: Small cell lung cancer (SCLC) is highly lethal with no effective therapy. Wee1 kinase inhibitor AZD1775 (MK-1775) and mTOR kinase inhibitor MLN0128 (TAK228) are in clinical trials for relapsed SCLC and recurrent lung cancer, respectively. However, there is no
Xiaoqing Guo et al.
Anti-cancer drugs, 28(1), 66-74 (2016-09-08)
Tumor necrosis factor related apoptosis-inducing ligand (TRAIL) is a cytokine that selectively induces apoptosis in many tumor cells while leaving normal cells intact and is thus an attractive candidate for antitumor therapies. This paper reports that the combination of tunicamycin
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.