콘텐츠로 건너뛰기
Merck

EHU030881

Sigma-Aldrich

MISSION® esiRNA

targeting human EIF2AK3, AC104134.2

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGGGGCACTCCTTTGAACTTTGTCCTTCTGAAGCTTCTCCTTATGTAAGGTCAAGGGAGAGAACCTCCTCTTCAATAGTATTTGAAGATTCTGGCTGTGATAATGCTTCCAGTAAAGAAGAGCCGAAAACTAATCGATTGCATATTGGCAACCATTGTGCTAATAAACTAACTGCTTTCAAGCCCACCAGTAGCAAATCTTCTTCTGAAGCTACATTGTCTATTTCTCCTCCAAGACCAACCACTTTAAGTTTAGATCTCACTAAAAACACCACAGAAAAACTCCAGCCCAGTTCACCAAAGGTGTATCTTTACATTCAAATGCAGCTGTGCAGAAAAGAAAACCTCAAAGACTGGATGAATGGACGATGTACCATAGAGGAGAGAGAGAGGAGCGTGTGTCTGCACATCTTCC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Qun Huang et al.
Molecular and cellular biochemistry, 431(1-2), 67-74 (2017-03-03)
Studies have demonstrated that the high-mobility group 1B protein (HMGB1) could regulate endothelial progenitor cell (EPC) homing, but the effect of HMGB1 on EPC apoptosis and associated mechanisms are still unclear. The aim of this study was to investigate the
Palsamy Periyasamy et al.
Autophagy, 12(8), 1310-1329 (2016-06-24)
Cocaine is known to induce inflammation, thereby contributing in part, to the pathogenesis of neurodegeneration. A recent study from our lab has revealed a link between macroautophagy/autophagy and microglial activation. The current study was aimed at investigating whether cocaine could
Qiao Qiao et al.
Cancer science, 108(7), 1421-1431 (2017-04-19)
Endoplasmic reticulum stress (ERS) plays an important role in the pathogenesis and development of malignant tumors, as well as in the regulation of radiochemoresistance and chemoresistance in many malignancies. ERS signaling pathway protein kinase RNA-like endoplasmic reticulum kinase (PERK)-eukaryotic initiation
Saiprasad Ramnarayanan et al.
Biology of reproduction, 95(6), 120-120 (2016-10-14)
There is considerable evidence that implicates oxidative stress in the pathophysiology of human pregnancy complications. However, the role and the mechanism of maintaining an antioxidant prosurvival uterine environment during normal pregnancy is largely unresolved. Herein we report that the highly
Yan Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 125, 110022-110022 (2020-02-29)
Pathological cardiac hypertrophy is characterized by myocyte enlargement and cardiac dysfunction. However, the pathogenesis for this disease is still poorly understood. Stimulator of interferon genes (STING) could meditate inflammation and immune response in various kinds of diseases. In this work

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.