설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCCACACTTACCTTGCCAATGGCCAGACCAAGGTGCTGACTCAGAAGTTGTCATCAGTCAGAGGCAATCATATTATCTCAGGGACATGCGCATCATGGCGTGGCAAGAGCCTTCGGGTTCAGAAGATCAGGCCTTCTATCCTGGGCTGCAACATCCTTCGAGTTGAATATTCCTTACTGATCTATGTTAGCGTTCCTGGATCCAAGAAGGTCATCCTTGACCTGCCCCTGGTAATTGGCAGCAGATCAGGTCTAAGCAGCAGAACATCCAGCATGGCCAGCCGAACCAGCTCTGAGATGAGTTGGGTAGATCTGAACATCCCTGATACCCCAGAAGCTCCTCCCTGCTATATGGATGTCATTCCTGAAGATCACCGATTGGAGAGCCCAACCACTCCTCTGCTAGATGACATGGATGGCTCTCAAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... TXNIP(10628), TXNIP(10628)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Takhellambam S Devi et al.
Biology open, 8(4) (2019-04-27)
Thioredoxin-interacting protein (TXNIP) plays a critical role in oxidative stress, inflammation, apoptosis and the pathogenesis of diabetic retinopathy (DR). However, the role of TXNIP in high glucose-induced retinal pigment epithelium (RPE) dysfunction is still unknown. Here, we show that high
Jianjun Jiang et al.
Lipids in health and disease, 20(1), 19-19 (2021-02-23)
This study aimed to explore the effects of ceramide (Cer) on NLRP3 inflammasome activation and their underlying mechanisms. Lipopolysaccharide (LPS)/adenosine triphosphate (ATP)-induced NLRP3 inflammasome activation in J774A.1 cells and THP-1 macrophages was used as an in vitro model of inflammation.
Tina Oberacker et al.
FEBS letters, 592(13), 2297-2307 (2018-06-14)
The "free radical theory of aging" suggests that reactive oxygen species (ROS) are responsible for age-related loss of cellular functions and, therefore, represent the main cause of aging. Redox regulation by thioredoxin-1 (TRX) plays a crucial role in responses to
Qing Zhao et al.
Journal of neuroinflammation, 14(1), 104-104 (2017-05-12)
Early brain injury (EBI) is considered a major contributor to the high morbidity and mortality associated with subarachnoid haemorrhage (SAH). Both of sterile inflammation and apoptosis are considered the important causes of EBI. Recently, it was confirmed that thioredoxin-interacting protein
Chad N Brocker et al.
Nature communications, 11(1), 5847-5847 (2020-11-19)
Exploring the molecular mechanisms that prevent inflammation during caloric restriction may yield promising therapeutic targets. During fasting, activation of the nuclear receptor peroxisome proliferator-activated receptor α (PPARα) promotes the utilization of lipids as an energy source. Herein, we show that
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.