설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGACCCAGTTGATGGAAAGACTAAAGCCATCTATGCAGCACATGTTTATGAAGTTCTATTCTGCCCACTTATTCCAGAATGGCAGTGTATTAGTAGGAGAGCTCTACAGCTATGGAACATTATTAAATGCCATTAACCTCTATAAAAATACCCCTGAAAAAGTGATGCCTCAAGGTCTTGTCATCTCTTTTGCTATGAGAATGCTTTACATGATTGAGCAAGTGCATGACTGTGAAATCATTCATGGAGACATTAAACCAGACAATTTCATACTTGGAAACGGGCAAGTATTTTTGGAACAGGATGATGAAGATGATTTATCTGCTGGCTTGGCACTGATTGACCTGGGTCAGAGTATAGATATGAAACTTTTTCCAAAAGGAACTATATTCACAGCAAAGTGTGAAACATCTGGTTTTCAGTGTGTTGAGATGCTCAGCAACAAACCATGGAACTACCAGATCGATTACTTTGGGGTTGCTGCAACAGTATATTGCATGCTCTTTGGCAC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Mathijs Vleugel et al.
Journal of cell science, 128(16), 2975-2982 (2015-07-08)
Mitotic chromosome segregation is initiated by the anaphase promoting complex/cyclosome (APC/C) and its co-activator CDC20 (forming APC/C(CDC20)). APC/C(CDC20) is inhibited by the spindle assembly checkpoint (SAC) when chromosomes have not attached to spindle microtubules. Unattached kinetochores catalyze the formation of
Yutaka Matsubara et al.
Shock (Augusta, Ga.), 51(3), 364-371 (2018-04-03)
Severe sepsis is critical to health and can result in acute renal failure (ARF). Tissue factor (TF) and thrombomodulin (TM) play key roles in vascular endothelial functions by helping maintain microcirculation in the kidney. Budding uninhibited by benzimidazole-1 (Bub1) plays
Katharina Overlack et al.
Current biology : CB, 27(19), 2915-2927 (2017-09-26)
The spindle assembly checkpoint (SAC) prevents premature sister chromatid separation during mitosis. Phosphorylation of unattached kinetochores by the Mps1 kinase promotes recruitment of SAC machinery that catalyzes assembly of the SAC effector mitotic checkpoint complex (MCC). The SAC protein Bub3
Grégory Eot-Houllier et al.
Nature communications, 9(1), 1888-1888 (2018-05-16)
Sustained spindle tension applied to sister centromeres during mitosis eventually leads to uncoordinated loss of sister chromatid cohesion, a phenomenon known as "cohesion fatigue." We report that Aurora A-dependent phosphorylation of serine 7 of the centromere histone variant CENP-A (p-CENP-AS7)
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.