콘텐츠로 건너뛰기
Merck

EHU000311

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF1

로그인조직 및 계약 가격 보기

크기 선택


제품정보 (DICE 배송 시 비용 별도)

UNSPSC 코드:
41105324
NACRES:
NA.51
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의
기술 서비스
도움이 필요하신가요? 저희 숙련된 과학자 팀이 도와드리겠습니다.
도움 문의

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGTGTACCGGATGCTTCCACCTCTCACCAAGAACCAGAGAAAAGAAAGAAAGTCGAAGTCCAGCCGAGATGCTAAGAGCAAGGCCAAGAGGAAGTCATGTGGGGATTCCAGCCCTGATACCTTCTCTGATGGACTCAGCAGCTCCACTCTGCCTGATGACCACAGCAGCTACACAGTTCCAGGCTACATGCAGGACTTGGAGGTGGAGCAGGCCCTGACTCCAGCACTGTCGCCATGTGCTGTCAGCAGCACTCTCCCCGACTGGCACATCCCAGTGGAAGTTGTGCCGGACAGCACCAGTGATCTGTACAACTTCCAGGTGTCACCCATGCCCTCCACCTCTGAAGCTACAACAGATGAGGATGAGGAAGGGAAATTACCTGAGGACATCATGAAGCTCTTGGAGCAGTCGGAGTGGCAGCCAACAAACGTGGATGGGAAGGGGTACCTACTCAATGAACCTGGAGTCCAGCCCACCTCTGTCTATGGAGACTTTAGCTGTAAGGAGGAGCCAGAAATTGACAGCCCAGGGGGGGATATTGGGCTGAGTCTACAGCGTGTCTTCACAGATCTGAAGAACATGGATGCCACCT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jianhua Liu et al.
Arthritis & rheumatology (Hoboken, N.J.), 69(9), 1840-1849 (2017-06-01)
The inflammasome complex is a driver of organ damage in patients with systemic lupus erythematosus (SLE). Although type I interferons (IFNs) are well established as mediators of SLE pathogenesis, their role in inflammasome activation in SLE has not been assessed.
Yihe Yan et al.
Cancer immunology, immunotherapy : CII, 69(9), 1891-1903 (2020-05-08)
The objective response rate of immune checkpoint blockade (ICB) in hepatocellular carcinoma (HCC) with anti PD-L1/PD-1 therapy is low. Discovering the signaling pathways regulating PD-L1 might help to improve ICB response rates. Here, we investigate transcription factors IRF-1 and IRF-2
Z-D Liu et al.
European review for medical and pharmacological sciences, 24(23), 12334-12341 (2020-12-19)
Cerebral ischemia/reperfusion (CIR) frequently causes serious disabilities and correlates with certain neurological processes. Some studies have shown that microRNAs (miRNAs) exert a neuroprotective effect by modulating the inflammatory process in CIR. However, the biofunction and the mechanism of miR-130b in
Eri Sugiyama et al.
Science immunology, 5(43) (2020-02-02)
The clinical efficacy of anti-PD-1 (programmed cell death-1) monoclonal antibody (mAb) against cancers with oncogenic driver gene mutations, which often harbor a low tumor mutation burden, is variable, suggesting different contributions of each driver mutation to immune responses. Here, we
Meng Du et al.
Theranostics, 9(16), 4688-4703 (2019-08-02)
Deciphering the molecular and cellular processes involved in foam cell formation is critical to understanding the pathogenesis of atherosclerosis. Interferon regulatory factor 1 (IRF1) was first identified as a transcriptional regulator of type-I interferons (IFNs) and IFN inducible genes. Our

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.